• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Method to improve tolerance to abiotic stresses in an organism. The present invention relates to a genetic construct that encodes a new gene and/or its family that confers resistance to abiotic stresses. In particular, the present invention relates to a genetic construct comprising the sequence SEQ ID NO .: 1 or a sequence having at least 75% identity with the sequence SEQ ID NO .: 1. The present invention also relates to to a method for developing strains of microorganisms resistant to abiotic stresses by the genetic construction of the present invention. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2673521A1
    申请号:ES201631493
    申请日:2016-11-21
    公开日:2018-06-22
    发明作者:José RAMOS RUIZ；Samuel Alexis David GELIS
    申请人:Universidad de Cordoba；
    IPC主号:
    专利说明:

    image 1
    image2
    image3
    image4
    image5
    image6
    image7
    image8
    10
    fifteen
    twenty
    25
    30
    35

    CCCATTTACAACCGGATGTTGCGAGAGGGAATATTGAAGGTGCCGGCTCTCTTTACGACCCAGGTG ATATATGCAAACTACGCCGGCCGCTTTTTCTGTACGTTTGCCAAGTTATGCAATAACCGAATCATCG AGGAAGTGGTGACCAATCCCACCGACGAAGTGGTGAAGCGAGCGGTGATGGAGACGATCGAGAA GTATATTGTGGTGGAAGAAGACACGACTGAAATGTTTATGAAAGCCGTGATTATCTCGTTGATGCT TCCCGATGACCGGTTTGCGCAGTCGAAGGTGCGAGCCAAAATCTTTGACGGCATCAACTATTTCTT GAAGTTGGCTATAGCAGACTATATGTTGATGAGAAACAACGCCAAGGAGATTATCAAAAAACTGG GAGAATCTAGCATACCATGCATTTGA
    In another preferred embodiment, the genetic construct of the present invention comprises SEQ ID NO .: 5, or a sequence that has at least 75% identity with SEQ ID NO .: 5, such as 75%, 80 %, 85%, 90%, 95%, 97%, 98%, 99% identity with SEQ ID NO .: 5.
    SEQ ID NO .: 5 corresponds to the DNA sequence of DEHA2E00198g: ATGGAGTCGCACGAATTACGTATTAGAGAAGTCGGGGGAGTGTCTATTTTAGTGCACAAGGACAA AATAGTAAATCCTTTGGCTGAGAAATTTGCAAATAAATATCTACCACGTCTTATCGAAAGTAGTGA AATCCGCAGTACTATATTGTCGGAAATTAAAAGTTACTACCAGGAACATTCCAAACAGCATTATTT ATTGAAGCAGATAATTGCTGTTACAGATGACTCCGAGGTACCAGGAGTCAAAGAATCTAAGCTAA ATGTTTGCAAGCTTTGCTTCAATCATGCCTCAAAGTCACACATTAATCATCATCTTAGAACAGAACA CAGAGTCAATTGCAACTTCCAACGGCACGTCTTCAGAACAACCGGGTATGCAATTCCCAACCAAAA GTGCGGCTTTTCCTATATATACCGCGAAAAAGAAGACACCAAACCGCCCACTTCAATGACAACCAT CGAAGGCCCGCATACCCATCTCCGGCACGAGGACAAGTTCCTCCGCACAATCAACGCCAACCTATA TTACGGAAAGGGATACCCGCAGTATCTACACAGCGAAAACAAGGAAGAGAGCATACCGGTGTTTG AGGCCGTCAAGAAGTATATTCTCCAGGACAGGCCACATTTGAAAGGCACGCATCCCATTTACAACC GGATGTTGCGAGAGGGAATATTGAAGGTGCCGGTTCTCTTTACGACGCAGGTGATATATGCAAATT ACGCCGGCCGCTTTTTCTACACGTTTGCCAAGTTATGCGATAACCGAATCATCGAGGAGGTGGTGA CCAATCCCACCGACGAAGTGGTGAAGCGAGCGGTGATGGAGACGATCGAGAAGTATATTGTGGTG GAAGAAGACACGACTGAAACGTTTATGAAAGCCGTGATTATCTCGTTGATGCTTCCCGATGA CCGG TTTGCGCAGTCGAAGGTGCGAGCCAAAATCTTTGACGGCATCAACTATTTCTTGAAGTTGGCCATA GCAGACTAA
    Nucleic acid sequences such as the sequences depicted in SEQ ID NO .: 1-5, their complementary sequences or a variant of any of the above sequences that has at least 75%, or 80%, or 85% , or 89%, or 90%, or 91%, or 92%, or 95%, or 97%,
    or 99%, of identity with said sequences, can be operatively linked to a nucleotide sequence encoding a promoter, as a person skilled in the art can understand. The term "operably linked", as used herein, refers to the protein or proteins being (are) expressed in the correct reading frame under the control of the promoter and the control sequences or expression regulators
    10
    fifteen
    twenty
    25
    30
    35

    Optionally, in addition to a sequence that functions as a promoter, the genetic construct of the present invention may incorporate other control sequences or expression regulatory sequences. Control sequences are sequences that control and regulate transcription and, where appropriate, the translation of the protein of interest. In addition to promoters, they include sequences encoding transcriptional regulators, ribosome binding sequences (RBS) and / or transcription terminator sequences. Such expression control sequences may be functional in prokaryotic cells and organisms and / or in eukaryotic cells and organisms.
    Advantageously, said genetic construct may also comprise a marker or gene that codes for a motif or phenotype that allows the selection of the host cell transformed with said genetic construct. Illustrative examples of such markers that could be present in the genetic construct of the invention include antibiotic resistance genes, toxic compound resistance genes and, in general, all those that allow the selection of genetically transformed cells.
    Vector of the present invention The genetic construction of the present invention may be comprised in an appropriate vector. Therefore, in a second aspect, the present invention provides a vector comprising the genetic construction of the present invention. The vector can be any type of vector, such as a cloning vector, an expression vector or a plasmid.
    The term "cloning vector", as used herein, refers to any suitable vector for cloning, which generally implies the presence of restriction sites, an origin of replication for its propagation in bacteria and a marker. of selection.
    The term "expression vector", as used herein, refers to any suitable vector to express the protein (s) encoded by SEQ ID NO: 1- 5, its complementary sequences or a variant of any of the previous sequences that has at least 75%, or 80%, or 85%, or 89%, or 90%, or 91%, or 92 %, or 95%, or 97%,
    or 99%, of identity with said sequences.
    The present invention also relates to the use of the vectors of the present invention to transform, transfect or transduce microorganisms, preferably yeasts and / or bacteria, more preferably Saccharomyces cerevisiae, D. hansenii, Schwanniomyces occidentalis Pichia, Kluyveromyces and bacteria such as E. coli .

    The present invention also relates to the use of the vectors of the present invention to transform, transfect or transduce cells from higher organisms, preferably plant cells, more preferably from the Arabidopsis thaliana model plant or from any plant of interest.
    5 agricultural such as beans (Phaseolus vulgaris) and / or sunflower (Helianthus annuus).
    The term "transformation", as used in the description, refers to the introduction of external genetic material into prokaryotic or eukaryotic cells by means of plasmids, viral vectors (sometimes also referred to as transduction) or other tools for transfer.
    10 The term "transduction", as used in the description, refers to the process by which exogenous genetic material is introduced into a prokaryotic or eukaryotic cell using a virus as a vector.
    The term "transfection", as used in the description, refers to the introduction of external genetic material into eukaryotic cells or organisms by means of plasmids, viral vectors or other tools for transfer.
    Organisms of the present invention
    In a third aspect, the present invention provides an organism comprising the genetic construct or vector of the present invention. The organism of the present invention can be a microorganism, such as a bacterium or a yeast, or a higher organism, such as a plant.
    25 The term "microorganism", as used herein, refers to a living being.
    or a biological system that can only be visualized with the microscope. The term "microorganism" also refers to a unicellular or multicellular organism that can be eukaryotic or prokaryotic and can only be visualized with a microscope.
    In a preferred embodiment, the microorganism is a yeast. The term "yeast", as used in the description, refers to a eukaryotic organism, classified as a fungus, either ascomycetes or microscopic basidiomycetes, with a unicellular shape predominantly in its life cycle, generally characterized by being divided asexually by budding or Binary fission and has sexual states that are not attached to a sporocarp.
    35
    10
    fifteen
    twenty
    25
    30
    35

    Preferably, the yeast is Saccharomyces cerevisiae, Pichia, Kluyveromyces, D. hansenii and / or Schwanniomyces occidentalis.
    In another preferred embodiment, the microorganism is a bacterium, preferably E. coli.
    In another preferred embodiment, the organism is a plant. Preferably, the plant is Arabidopsis thaliana and / or plants of agricultural interest such as beans (Phaseolus vulgaris) or sunflower (Helianthus annuus).
    Uses of the present invention In a fourth aspect, the present invention provides the use of the genetic construction of the present invention and / or the vector of the present invention to improve tolerance to abiotic stresses in an organism.
    The term "abiotic stress", as used in the description, refers to the negative impact caused by inert factors to an organism. For example, but not limited to, temperature, salinity, oxidizing agent, toxic agent, mechanical effects, pH, osmolarity and radiation are inert factors that can cause a negative impact on an organism, such as a microorganism such as like yeasts or bacteria, or a plant.
    In a preferred embodiment, the genetic construction and / or the vector of the present invention improves tolerance in an organism such as a microorganism (for example, yeasts or bacteria), or a plant, to stress induced by an elevated temperature, a low temperature and / or a variable temperature. The term "elevated temperature", as used herein, refers to a temperature that is above the optimum temperature of an organism. The term "low temperature", as used herein, refers to a temperature that is below the optimum temperature of an organism. The term "variable temperature", as used in the present description, refers to a temperature that fluctuates above and / or below the optimum temperature of said organism. The term "optimal temperature", as used in the present description, refers to the temperature where the growth and replication of an organism is maximized.
    The term "salinity," as used in the description, refers to the concentration of salt in the environment where the organism is found, such as a microorganism (for example, yeasts
    or bacteria), or a plant. In a preferred embodiment, the genetic construct and / or the vector of the present invention improves tolerance in an organism such as a microorganism (e.g.,
    image9
    10
    fifteen
    twenty
    25
    30
    35

    induced by an oxidizing agent. In another preferred embodiment, the genetic construction and / or the vector of the present invention improve tolerance in an organism such as a microorganism (for example, yeast or bacteria), or a plant to the stress induced by hydrogen peroxide.
    The term "toxic agent", as used herein, refers to compounds or molecules that have an ability to cause harmful effects on a living being, upon contact with it. In a preferred embodiment, the genetic construction and / or the vector of the present invention improve tolerance in an organism such as a microorganism (for example, yeast or bacteria), or a plant to the stress induced by a toxic agent. In another preferred embodiment, the genetic construct and / or the vector of the present invention improve tolerance in an organism such as a microorganism (eg, yeasts or bacteria), or a plant to sodium-induced stress. In another preferred embodiment, the genetic construct improves the tolerance in a microorganism to a sodium concentration of at least 0.2 M, 0.4 M, 0.5 M, 0.6 M, 0.8 M, 1.0 M,
    1.2 M, 1.4 M, 1.5 M, 1.6 M, 1.8 M, 2.0 M, 2.2 M or 2.4 M. In another preferred embodiment, the genetic construct improves tolerance in an organism at a lithium concentration of at least between 0.05 and 0.8 M, such as 0.05 M, 0.1 M, 0.2 M, 0.3 M, 0.4 M, 0.5 M, 0.6 M, 0.7 M or 0.8 M. In another preferred embodiment, the genetic construct improves tolerance in an organism at a concentration of Potassium of at least 0.2 M to 2.4 M, such as 0.2 M, 0.4 M, 0.6 M, 0.8 M, 1.0 M, 1.2 M, 1.4 M, 1.6 M, 1.8 M, 2.0 M, 2.2 M or 2.4 M. In another preferred embodiment, the genetic construct improves the tolerance in an organism at a concentration of cesium of at least between 0.05 M to 2.0 M, such as 0.05 M, 0.1 M, 0.2 M, 0.4 M, 0.5 M, 0.6 M, 0.8 M, 1.0 M, 1.2 M, 1.4 M, 1.5 M,
    1.6M, 1.8M or 2.0M.
    The term "mechanical effect", as used herein, refers to damage caused to organisms such as a microorganism (for example, yeast or bacteria), or a plant due to physical factors such as vibrations, collisions and extension, contraction and / or rupture of the cell wall and / or cell membrane. In a preferred embodiment, the genetic construction and / or vector of the present invention improve the tolerance of an organism such as a microorganism (for example, yeast or bacteria), or a plant to stress induced by a mechanical effect.
    In another preferred embodiment, the genetic construction and / or vector of the present invention improve tolerance in an organism such as a microorganism (for example, yeasts or bacteria), or a plant to stress induced by a high pH, a low pH and / or a variable pH. The term "high pH," as used herein, refers to a pH that is above the optimum pH of an organism. The term "low pH," as used herein, refers to a pH that is below the optimum pH of an organism. The term "variable pH", as it is
    10
    fifteen
    twenty
    25
    30
    35

    used in the present description, refers to a pH that fluctuates above and / or below the optimum pH. The term "optimal pH", as used herein, refers to the pH where the growth and replication of an organism such as a microorganism (eg, yeast or bacteria), or a plant is maximized.
    In another preferred embodiment, the genetic construction and / or vector of the present invention improve tolerance in an organism such as a microorganism (eg, yeast or bacteria), or a plant to stress induced by high osmolarity, low osmolarity and / or a variable osmolarity. The term "high osmolarity", as used in the present description, refers to an osmolarity that is above the optimal osmolarity of an organism. The term "low osmolarity," as used herein, refers to an osmolarity that is below the optimal osmolarity of an organism. The term "variable osmolarity", as used herein, refers to an osmolarity that fluctuates above and / or below the optimal osmolarity. The term "optimal osmolarity," as used herein, refers to osmolarity where the growth and replication of an organism such as a microorganism (eg, yeast or bacteria), or a plant is maximized. .
    In another preferred embodiment, the genetic construction and / or vector of the present invention improve the tolerance of an organism such as a microorganism (eg, yeast or bacteria), or a plant to radiation induced stress.
    In a preferred embodiment, the genetic construction and / or vector of the present invention confer an increase in salt tolerance, preferably sodium, lithium, cesium and / or potassium, in an organism such as a microorganism ( for example, yeasts or bacteria), or a plant. In an alternative preferred embodiment, the genetic construction and / or the vector of the present invention confer an increase in resistance to oxidative stress in an organism such as a microorganism (for example, yeasts or bacteria), or a plant.
    Method for improving tolerance to abiotic stresses A fifth aspect of the present invention relates to a method for improving tolerance to abiotic stresses in an organism such as a microorganism (eg, yeasts or bacteria), or a plant, which comprises express the product (s) of SEQ ID NO .: 1 or a sequence that has at least 75% identity with SEQ ID NO .: 1, such as 75%, 80%, 85% , 89%, 90%, 91%, 92%, 95%, 97%, or 99% identity with SEQ ID NO .: 1 in a microorganism above the endogenous expression levels of said product (s) ( s).
    10
    fifteen
    twenty
    25
    30
    35

    In another preferred embodiment, but not limited to, the method comprises expressing the product (s) of the sequence (s) depicted in SEQ ID NO .: 1-5, its complementary sequences or a variant of any of the previous sequences that have at least 75%, or 80%, or 85%, or 89%,
    or 90%, or 91%, or 92%, or 95%, or 97%, or 99%, of identity with said sequences in an organism such as a microorganism (for example, yeasts or bacteria ), or a plant, above the endogenous expression levels of said product (s).
    In a preferred embodiment, the method is characterized by the overexpression of the product (s) of the sequence (s) represented in SEQ ID NO .: 1-5, its complementary sequences or a variant of any of the previous sequences that have at least 75%, or 80%, or 85%, or 89%, or 90%, or 91%, or 92%, or 95%, or 97% , or 99%, of identity with said sequences in an organism such as a microorganism (for example, yeasts or bacteria), or a plant, above levels of endogenous expression of said product.
    The term "above levels of endogenous expression", as used herein, refers to the expression of the product (s) of the sequence (s) represented in SEQ ID NO .: 1-5, its complementary sequences or a variant of any of the above sequences that has at least 75%, or 80%, or 85%, or 89%, or 90%, or 91%, or 92%, or 95%, or 97%, or 99%, of identity with said sequences at a level (s) higher than the levels normally found in the host organism
    In a preferred embodiment, the method also comprises, but is not limited to, a stage where an organism strain resistant to abiotic stress is selected such as a microorganism (for example, yeasts or bacteria), or a plant, by exposing multiple cells to abiotic stress and subsequently choosing the cells that grow and replicate better. The selection stage must be completed after step (a) where the product (s) of the sequence (s) represented in SEQ ID NO .: 1-5, its complementary sequences or a variant is overexpressed. of any of the above sequences that have at least 75%, or 80%, or 85%, or 89%, or 90%, or 91%, or 92%, or 95%, or 97%, or 99%, of identity with said sequences in an organism such as a microorganism (for example, yeasts or bacteria), or a plant above endogenous expression levels of said product (s) .
    In a preferred embodiment, the temperature used for selection is a temperature between 4 to 90 ° C, preferably between 10 to 60 ° C and even more preferable between 15 to 40 ° C. In a preferred embodiment, the pH used for the selection is between 4 to 10, preferably between 5 to 9 and even more preferably between 6 to
    8. In a preferred embodiment, an oxidizing agent is used for selection. In another embodiment
    10
    fifteen
    twenty
    25
    30
    35

    Preferably, hydrogen peroxide is used at a concentration of at least 5 µM to 50 mM, such as at least 5 µM, 50 µM, 0.1 mM, 0.5 mM, 5 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM or 50 mM or more for selection. In a preferred embodiment, a sodium concentration of between 0.2 M to 2.4 M is used, such as at least 0.2 M, 0.4 M, 0.5 M, 0.6 M, 0.8 M, 1.0 M, 1.2 M, 1.4 M, 1.5 M , 1.6 M, 1.8 M, 2.0 M, 2.2 M or 2.4 M for selection. In another preferred embodiment, a lithium concentration of at least between 0.05 M and 0.8 M is used, such as 0.05 M, 0.1 M, 0.2 M,
    0.3 M, 0.4 M, 0.5 M, 0.6 M, 0.7 M or 0.8 M. In another preferred embodiment, a potassium concentration of at least 0.2 M to 2.4 M is used, such as 0.2 M, 0.4 M, 0.6 M, 0.8 M, 1.0 M, 1.2 M, 1.4 M,
    1.6 M, 1.8 M, 2.0 M, 2.2 M or 2.4 M. In another preferred embodiment, a cesium concentration of at least 0.05 M to 2.0 M is used, such as 0.05 M, 0.1 M, 0.2 M, 0.4 M, 0.5 M, 0.6 M, 0.8 M, 1.0 M, 1.2 M, 1.4 M, 1.5 M, 1.6 M, 1.8M or 2.0M.
    If not specifically mentioned to the contrary, the term “understand” is used, in the context of this application, to indicate that the list of components may include optional aspects mentioned
    or not mentioned. The term "understand" may also include the concept "consists of".
    Examples Example 1: Identification of the DEHA2B00132g gene (SEQ ID NO .: 1)
    The tests of this work have been carried out mostly with the wild yeast strain Saccharomyces cerevisiae BY4741. Escherichia coli DH5α bacteria were used for the transformation assays. In some trials the wild strain of Debaryomyces hansenii was used with deposit number CBS 767, publicly available in the collection of the Centraalbureau voor Schimmelcultures (CBS), The Netherlands.
    In the first experiments, a library of Debaryomyces hansenii PYCC2968 contained in plasmid YEp352 in E. coli DH5α was used and the wild strain of S. cerevisiae was transformed. The salinity tolerance was then tested in the different strains as described in Example 3.
    After transforming Saccharomyces cerevisiae with the Debaryomyces hansenii library, clones were obtained that underwent a first NaCl tolerance study (Figure 1). Figure 2 shows the growth of some clones already selected. The sequences of the two transformants that presented greater resistance corresponded to SEQ ID NO .: 1.
    Example 2: Computer analysis
    Method used for computer analysis.
    image10

    Central Research Support Service (SCAI) of the University of Córdoba. Once the sequences were obtained, those plasmids that did not show mutations in the open reading phase of the DEHA2B00132g gene (SEQ ID NO .: 1) were selected. Of the 5 plasmids analyzed, 3 had the correct sequence.
    Digestions were then carried out with the restriction enzymes EcoRI and SalI both to the plasmids pSPARK® that had the correct sequence, to release the insert, and to the expression plasmid pWS93 to linearize it. Both digestions were purified on agarose gel and a new ligation was carried out between both the insert and the open plasmid pWS93. The plasmid resulting from ligation was called pSUP.
    With the ligation mixture, E. coli was transformed. The transformation product was plated in LB solid medium with ampicillin and 8 transformants were selected with which a colony PCR was performed to select those containing the pSUP. The results obtained with the PCR showed that 6 selected transformants carried the plasmid with the cloned gene. The plasmid pSUP was extracted from one of them.
    Finally, the laboratory strain BY4741 of S. cerevisiae was transformed, on the one hand with the plasmid pSUP, carrier of the study gene, and on the other, with the plasmid pWS93 as a control. This strain of S. cerevisiae is characterized by being ura3-and since the expression plasmid used is URA3, it served us to be able to discriminate the plasmid-carrying transformants both with and without the insert.
    Example 4: Sensitivity to salt and hydrogen peroxide
    The salinity effect was performed as follows: The strains were preinoculated in 20 ml of YNB (ura-) and allowed to grow for 24 h at 28 ° C and 200 rpm. Subsequently the concentration of cells was adjusted to a D.O. 600nm = 1, from this serial dilutions were made in sterile water (1/10, 1/100, 1/1000, 1/10000). The inoculation in the plates was done by drops, made by taking 4μl of the different cell suspensions in an order of higher to lower concentration.
    Salt sensitivity was studied by supplementing the plates (or liquid medium) with NaCl at the appropriate concentrations.
    10
    fifteen
    twenty
    25
    30
    35

    Figure 4 shows that the strain expressing SEQ ID NO .: 1 (clone pSUP) shows greater tolerance to NaCl compared to the control strain (clone pWS93) and similar results were obtained in liquid medium (Figure 5).
    The effect of oxidative stress was performed as follows: An inoculum was made in 25 ml of liquid YPD for the pWS93 (control) and pSUP1 (carrier clone of the DEHA2B00132, (SEQ ID NO .: 1) strains. This inoculum was incubated at 28 ° C until an absorbance at 600 nm of 0.5 is obtained (OD600 nm = 0.5). Upon reaching the required cell concentration, 1 mL of culture was transferred to an eppendorff, which was centrifuged for 2 minutes at 5000 rpm. Supernatant was discarded and the resulting cell pellet resuspended in 1 mL of PBS buffer, finally, the volume of H2O2 required to reach the study concentrations (5 mM; 10 mM; 15 mM) was added to each of the eppendorffs. prepared from each strain was free of peroxide to be used as a control.
    The effect of subjecting yeasts to this type of oxidative stress was analyzed by performing a drip test. For this, 5μL of preparation was inoculated in YPD plates at different times (minute 0, minute 5, minute 10, minute 20, minute 30 and minute 40), counting from the addition of H2O2. These plates were incubated in the oven at 28 ° C for 24-72 hours.
    Figure 6 shows that the strain expressing the gene DEHA2B00132 (SEQ ID NO .: 1) (clone pSUP) shows greater tolerance to a treatment with hydrogen peroxide (H2O2) compared to the control strain (clone pWS93).
    Example 5: Verification of the involvement of the DEHA00132g gene (SEQ ID NO.:1) in tolerance to saline stress
    When the clone grows with the gene of interest in medium without selective pressure (with Ura) for several generations they lose the plasmid and, therefore, they should lose the acquired character. Those colonies that presented growth in YPD but not in the medium without Ura and, therefore, had expelled the plasmid, were selected for verification of its implication in salt tolerance.
    Verification of the involvement of the DEHA00132g gene (SEQ ID NO .: 1) in tolerance to saline stress was carried out by a drip test at various concentrations of NaCl in YPD plates, where the growth of the colonies obtained was compared. with that of transformed strains.
    The loss of the plasmid (with the gene of interest) implied the loss of the salt tolerance character (Figure 7).

    Example 6: Polymerase chain reaction with reverse transcriptase (RT-qPCR)
    The cells were treated for 30 minutes with NaCl (0.5 M) or with hydrogen peroxide (H2O2) (50 µM). Cellular RNA, which was treated with DNase, was extracted, quantified, re-transcribed and PCR was performed using the Bio-Rad MJMini Personal Thermal Cycler thermal cycler. The primers used can be found in Table 1 Table 1
    image11
    10 The results of the first experiment can be seen in Figure 8, where it is observed that only two of the genes are quantitatively affected when they are subjected to NaCl treatment (0.5 M), a very significant repression being observed in the case of gene 132 (2.5 times) and a significant induction in the case of the 19448 gene (1.9 times) upon treatment. Treatment using KCl instead of NaCl did not produce significant responses in gene expression, indicating that
    15 We are not dealing with an exclusively osmotic issue but with responses to salt toxicity (results not shown). Figure 9 shows that there is a very significant difference for the 27434 gene, and a significant difference for the 19448 gene after an oxidative stress inducing treatment.
    权利要求:
    Claims (1)
    [1]
    image 1
    image2
    类似技术:
    公开号 | 公开日 | 专利标题
    Rivera et al.2014|Physical methods for genetic transformation of fungi and yeast
    JP6180002B2|2017-08-16|Mutant reverse transcriptase
    Zhang et al.2013|Disruption of AtWNK8 enhances tolerance of Arabidopsis to salt and osmotic stresses via modulating proline content and activities of catalase and peroxidase
    Fukuhara1995|Linear DNA plasmids of yeasts
    CN101586119B|2011-04-06|Tetrahymena transgenic carrier containing HSP70 promoter and GFP and preparation method and use thereof
    Grant et al.2006|Identification of eukaryotic open reading frames in metagenomic cDNA libraries made from environmental samples
    ES2464740T3|2014-06-03|Method to generate a genetically modified microbe
    Malavazi et al.2012|Gene disruption in Aspergillus fumigatus using a PCR-based strategy and in vivo recombination in yeast
    CN106834336A|2017-06-13|A kind of heterogenous expression and purification process of Trichoderma harzianum acid protease P6281
    Liu et al.2016|An extracellular Zn‐only superoxide dismutase from Puccinia striiformis confers enhanced resistance to host‐derived oxidative stress
    JP5733609B2|2015-06-10|A novel promoter used to transform algae
    US20170268013A1|2017-09-21|Vector containing centromere dna sequence and use thereof
    ES2673521A1|2018-06-22|Method to improve tolerance to abiotic stress in an organism |
    Hobl et al.2013|Bacteriophage T7 RNA polymerase-based expression in Pichia pastoris
    Ianiri et al.2020|Approaches for genetic discoveries in the skin commensal and pathogenic Malassezia yeasts
    Ko et al.2017|Heterologous expression of the carrot Hsp17. 7 gene increased growth, cell viability, and protein solubility in transformed yeast | under heat, cold, acid, and osmotic stress conditions
    CN102268443B|2013-01-30|Application of corn WRKY gene in enhancing plant stress tolerance
    ES2381433T3|2012-05-28|Expression system for proteins
    Thanh et al.2011|Cloning and characterization of ribulose-1, 5-bisphosphate carboxylase/oxygenase small subunit | cDNA from green microalga Ankistrodesmus convolutus
    CN102993278B|2014-02-19|Purification method of methicillin-resistant staphylococcus aureus | vaccine recombinant protein antigen FnbA1
    CN104059931B|2017-01-11|RNA interference vector of bactrocera dorsalis cytochrome P450 genes and construction method and application thereof
    Yu2007|A new approach to the production of the recombinant SOD protein by methylotrophic Pichia pastoris
    CN104059938B|2016-06-15|The rna interference vector of citrus fruit fly paravoltage dependent sodium channel gene and construction method thereof and application
    CN102373189A|2012-03-14|Fatty acid synthesis-related protein and encoding gene and application thereof
    Takayama2020|Identification of Genes Encoding CENP-A and Heterochromatin Protein 1 of Lipomyces starkeyi and Functional Analysis Using Schizosaccharomyces pombe
    同族专利:
    公开号 | 公开日
    ES2673521B1|2019-04-22|
    WO2018091758A1|2018-05-24|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    2018-06-22| BA2A| Patent application published|Ref document number: 2673521 Country of ref document: ES Kind code of ref document: A1 Effective date: 20180622 |
    2019-04-22| FG2A| Definitive protection|Ref document number: 2673521 Country of ref document: ES Kind code of ref document: B1 Effective date: 20190422 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201631493A|ES2673521B1|2016-11-21|2016-11-21|Method to improve tolerance to abiotic stress in an organism|ES201631493A| ES2673521B1|2016-11-21|2016-11-21|Method to improve tolerance to abiotic stress in an organism|
    PCT/ES2017/070762| WO2018091758A1|2016-11-21|2017-11-17|Method for improving tolerance to abiotic stresses in an organism|
    [返回顶部]